ID: 1203234587

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270731v1_random:142722-142744
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203234583_1203234587 -10 Left 1203234583 22_KI270731v1_random:142709-142731 CCTGGAGCCCTCGCAGCTGTCTC No data
Right 1203234587 22_KI270731v1_random:142722-142744 CAGCTGTCTCTCTTGGACTTAGG No data
1203234576_1203234587 21 Left 1203234576 22_KI270731v1_random:142678-142700 CCCTGCTGCCAAAGACACTGGGG No data
Right 1203234587 22_KI270731v1_random:142722-142744 CAGCTGTCTCTCTTGGACTTAGG No data
1203234573_1203234587 29 Left 1203234573 22_KI270731v1_random:142670-142692 CCTCTCGGCCCTGCTGCCAAAGA No data
Right 1203234587 22_KI270731v1_random:142722-142744 CAGCTGTCTCTCTTGGACTTAGG No data
1203234578_1203234587 20 Left 1203234578 22_KI270731v1_random:142679-142701 CCTGCTGCCAAAGACACTGGGGG No data
Right 1203234587 22_KI270731v1_random:142722-142744 CAGCTGTCTCTCTTGGACTTAGG No data
1203234581_1203234587 13 Left 1203234581 22_KI270731v1_random:142686-142708 CCAAAGACACTGGGGGGTTTCTT No data
Right 1203234587 22_KI270731v1_random:142722-142744 CAGCTGTCTCTCTTGGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203234587 Original CRISPR CAGCTGTCTCTCTTGGACTT AGG Intergenic
No off target data available for this crispr