ID: 1203239518

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:1588-1610
Sequence TTGCAGCCCTACCACTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203239518_1203239519 5 Left 1203239518 22_KI270733v1_random:1588-1610 CCTTTTCAGTGGTAGGGCTGCAA No data
Right 1203239519 22_KI270733v1_random:1616-1638 AGTATTTTAGCGTTAGCCTTTGG No data
1203239518_1203239520 13 Left 1203239518 22_KI270733v1_random:1588-1610 CCTTTTCAGTGGTAGGGCTGCAA No data
Right 1203239520 22_KI270733v1_random:1624-1646 AGCGTTAGCCTTTGGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203239518 Original CRISPR TTGCAGCCCTACCACTGAAA AGG (reversed) Intergenic
No off target data available for this crispr