ID: 1203239677

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:3732-3754
Sequence TCTCTGAGTAGACCAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203239676_1203239677 4 Left 1203239676 22_KI270733v1_random:3705-3727 CCAAGACTAAACGAGGAAGAAGT 0: 63
1: 8146
2: 3955
3: 2093
4: 2188
Right 1203239677 22_KI270733v1_random:3732-3754 TCTCTGAGTAGACCAATAGCAGG No data
1203239673_1203239677 12 Left 1203239673 22_KI270733v1_random:3697-3719 CCACACCTCCAAGACTAAACGAG No data
Right 1203239677 22_KI270733v1_random:3732-3754 TCTCTGAGTAGACCAATAGCAGG No data
1203239672_1203239677 23 Left 1203239672 22_KI270733v1_random:3686-3708 CCTGGAAACATCCACACCTCCAA No data
Right 1203239677 22_KI270733v1_random:3732-3754 TCTCTGAGTAGACCAATAGCAGG No data
1203239675_1203239677 7 Left 1203239675 22_KI270733v1_random:3702-3724 CCTCCAAGACTAAACGAGGAAGA No data
Right 1203239677 22_KI270733v1_random:3732-3754 TCTCTGAGTAGACCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203239677 Original CRISPR TCTCTGAGTAGACCAATAGC AGG Intergenic
No off target data available for this crispr