ID: 1203240574

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:12656-12678
Sequence TCGATTGTCCCCGTGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203240574_1203240579 11 Left 1203240574 22_KI270733v1_random:12656-12678 CCCTCAAACACGGGGACAATCGA No data
Right 1203240579 22_KI270733v1_random:12690-12712 CGAGTAATAACAGAGAATGCCGG No data
1203240574_1203240580 15 Left 1203240574 22_KI270733v1_random:12656-12678 CCCTCAAACACGGGGACAATCGA No data
Right 1203240580 22_KI270733v1_random:12694-12716 TAATAACAGAGAATGCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203240574 Original CRISPR TCGATTGTCCCCGTGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr