ID: 1203243533

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:41868-41890
Sequence GTCAGGTTACCTACAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203243533_1203243538 25 Left 1203243533 22_KI270733v1_random:41868-41890 CCTCCATTTGTAGGTAACCTGAC No data
Right 1203243538 22_KI270733v1_random:41916-41938 TATTTCCTTCATTTCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203243533 Original CRISPR GTCAGGTTACCTACAAATGG AGG (reversed) Intergenic
No off target data available for this crispr