ID: 1203248807

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:96411-96433
Sequence CAACTAGGATTGGTGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203248807_1203248813 13 Left 1203248807 22_KI270733v1_random:96411-96433 CCTTGCTACACCAATCCTAGTTG No data
Right 1203248813 22_KI270733v1_random:96447-96469 ACCATATGCATGTTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203248807 Original CRISPR CAACTAGGATTGGTGTAGCA AGG (reversed) Intergenic
No off target data available for this crispr