ID: 1203248869

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:96862-96884
Sequence CAGGACCCATAACATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203248862_1203248869 -3 Left 1203248862 22_KI270733v1_random:96842-96864 CCATCTTCTGGTAACATGCCCAG No data
Right 1203248869 22_KI270733v1_random:96862-96884 CAGGACCCATAACATGGGCAGGG No data
1203248861_1203248869 -2 Left 1203248861 22_KI270733v1_random:96841-96863 CCCATCTTCTGGTAACATGCCCA No data
Right 1203248869 22_KI270733v1_random:96862-96884 CAGGACCCATAACATGGGCAGGG No data
1203248860_1203248869 -1 Left 1203248860 22_KI270733v1_random:96840-96862 CCCCATCTTCTGGTAACATGCCC No data
Right 1203248869 22_KI270733v1_random:96862-96884 CAGGACCCATAACATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203248869 Original CRISPR CAGGACCCATAACATGGGCA GGG Intergenic
No off target data available for this crispr