ID: 1203251605

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:121810-121832
Sequence GCTCCCCGGCACCCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203251605_1203251615 -8 Left 1203251605 22_KI270733v1_random:121810-121832 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203251615 22_KI270733v1_random:121825-121847 CGGGGAGCGGTCCCCGGGCCGGG No data
1203251605_1203251614 -9 Left 1203251605 22_KI270733v1_random:121810-121832 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203251614 22_KI270733v1_random:121824-121846 CCGGGGAGCGGTCCCCGGGCCGG No data
1203251605_1203251616 -2 Left 1203251605 22_KI270733v1_random:121810-121832 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203251616 22_KI270733v1_random:121831-121853 GCGGTCCCCGGGCCGGGCCGCGG No data
1203251605_1203251623 22 Left 1203251605 22_KI270733v1_random:121810-121832 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203251623 22_KI270733v1_random:121855-121877 CCCTCTGCCGCGATCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203251605 Original CRISPR GCTCCCCGGCACCCGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr