ID: 1203251901

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:122825-122847
Sequence CACCGCCGGCGGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203251901_1203251915 8 Left 1203251901 22_KI270733v1_random:122825-122847 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203251915 22_KI270733v1_random:122856-122878 AAGGCGTGGGGTGCGGACCCCGG No data
1203251901_1203251914 1 Left 1203251901 22_KI270733v1_random:122825-122847 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203251914 22_KI270733v1_random:122849-122871 GTGTGGGAAGGCGTGGGGTGCGG No data
1203251901_1203251912 -5 Left 1203251901 22_KI270733v1_random:122825-122847 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203251912 22_KI270733v1_random:122843-122865 CGGTGCGTGTGGGAAGGCGTGGG No data
1203251901_1203251911 -6 Left 1203251901 22_KI270733v1_random:122825-122847 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203251911 22_KI270733v1_random:122842-122864 GCGGTGCGTGTGGGAAGGCGTGG No data
1203251901_1203251913 -4 Left 1203251901 22_KI270733v1_random:122825-122847 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203251913 22_KI270733v1_random:122844-122866 GGTGCGTGTGGGAAGGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203251901 Original CRISPR CACCGCCGGCGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr