ID: 1203252772

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:125576-125598
Sequence GCGCGCGCGCGCGTGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203252758_1203252772 11 Left 1203252758 22_KI270733v1_random:125542-125564 CCCCGCCTCGCCGCCGCCCGCGG No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252765_1203252772 1 Left 1203252765 22_KI270733v1_random:125552-125574 CCGCCGCCCGCGGGCGCCGGCCG No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252760_1203252772 10 Left 1203252760 22_KI270733v1_random:125543-125565 CCCGCCTCGCCGCCGCCCGCGGG No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252757_1203252772 15 Left 1203252757 22_KI270733v1_random:125538-125560 CCGTCCCCGCCTCGCCGCCGCCC No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252766_1203252772 -2 Left 1203252766 22_KI270733v1_random:125555-125577 CCGCCCGCGGGCGCCGGCCGCGC No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252762_1203252772 9 Left 1203252762 22_KI270733v1_random:125544-125566 CCGCCTCGCCGCCGCCCGCGGGC No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252768_1203252772 -6 Left 1203252768 22_KI270733v1_random:125559-125581 CCGCGGGCGCCGGCCGCGCGCGC No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252763_1203252772 6 Left 1203252763 22_KI270733v1_random:125547-125569 CCTCGCCGCCGCCCGCGGGCGCC No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data
1203252767_1203252772 -5 Left 1203252767 22_KI270733v1_random:125558-125580 CCCGCGGGCGCCGGCCGCGCGCG No data
Right 1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203252772 Original CRISPR GCGCGCGCGCGCGTGGCCGC CGG Intergenic