ID: 1203253499

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:128598-128620
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203253499_1203253504 -8 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253504 22_KI270733v1_random:128613-128635 GCGTGCGCCCCGCGCCGTGGGGG No data
1203253499_1203253503 -9 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253503 22_KI270733v1_random:128612-128634 GGCGTGCGCCCCGCGCCGTGGGG No data
1203253499_1203253510 5 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253510 22_KI270733v1_random:128626-128648 GCCGTGGGGGCGGGAACCCCCGG No data
1203253499_1203253512 6 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253512 22_KI270733v1_random:128627-128649 CCGTGGGGGCGGGAACCCCCGGG No data
1203253499_1203253516 20 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253516 22_KI270733v1_random:128641-128663 ACCCCCGGGCGCCTGTGGGGTGG No data
1203253499_1203253505 -5 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253505 22_KI270733v1_random:128616-128638 TGCGCCCCGCGCCGTGGGGGCGG No data
1203253499_1203253506 -4 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253506 22_KI270733v1_random:128617-128639 GCGCCCCGCGCCGTGGGGGCGGG No data
1203253499_1203253513 15 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253513 22_KI270733v1_random:128636-128658 CGGGAACCCCCGGGCGCCTGTGG No data
1203253499_1203253515 17 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253515 22_KI270733v1_random:128638-128660 GGAACCCCCGGGCGCCTGTGGGG No data
1203253499_1203253514 16 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253514 22_KI270733v1_random:128637-128659 GGGAACCCCCGGGCGCCTGTGGG No data
1203253499_1203253502 -10 Left 1203253499 22_KI270733v1_random:128598-128620 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203253502 22_KI270733v1_random:128611-128633 TGGCGTGCGCCCCGCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203253499 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic