ID: 1203255000

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:133562-133584
Sequence GCGCGCGCGTCCGCTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203254988_1203255000 0 Left 1203254988 22_KI270733v1_random:133539-133561 CCACCCCCACCCCACGTCTCGTC No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254990_1203255000 -4 Left 1203254990 22_KI270733v1_random:133543-133565 CCCCACCCCACGTCTCGTCGCGC No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254984_1203255000 4 Left 1203254984 22_KI270733v1_random:133535-133557 CCCCCCACCCCCACCCCACGTCT No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254994_1203255000 -10 Left 1203254994 22_KI270733v1_random:133549-133571 CCCACGTCTCGTCGCGCGCGCGT No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254980_1203255000 24 Left 1203254980 22_KI270733v1_random:133515-133537 CCGGCGGGCGCCGGCGCGCCCCC No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254982_1203255000 6 Left 1203254982 22_KI270733v1_random:133533-133555 CCCCCCCCACCCCCACCCCACGT No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254992_1203255000 -6 Left 1203254992 22_KI270733v1_random:133545-133567 CCACCCCACGTCTCGTCGCGCGC No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254981_1203255000 14 Left 1203254981 22_KI270733v1_random:133525-133547 CCGGCGCGCCCCCCCCACCCCCA No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254989_1203255000 -3 Left 1203254989 22_KI270733v1_random:133542-133564 CCCCCACCCCACGTCTCGTCGCG No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254993_1203255000 -9 Left 1203254993 22_KI270733v1_random:133548-133570 CCCCACGTCTCGTCGCGCGCGCG No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254987_1203255000 1 Left 1203254987 22_KI270733v1_random:133538-133560 CCCACCCCCACCCCACGTCTCGT No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254983_1203255000 5 Left 1203254983 22_KI270733v1_random:133534-133556 CCCCCCCACCCCCACCCCACGTC No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254979_1203255000 25 Left 1203254979 22_KI270733v1_random:133514-133536 CCCGGCGGGCGCCGGCGCGCCCC No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254991_1203255000 -5 Left 1203254991 22_KI270733v1_random:133544-133566 CCCACCCCACGTCTCGTCGCGCG No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254985_1203255000 3 Left 1203254985 22_KI270733v1_random:133536-133558 CCCCCACCCCCACCCCACGTCTC No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data
1203254986_1203255000 2 Left 1203254986 22_KI270733v1_random:133537-133559 CCCCACCCCCACCCCACGTCTCG No data
Right 1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203255000 Original CRISPR GCGCGCGCGTCCGCTGGGGG CGG Intergenic
No off target data available for this crispr