ID: 1203255393

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:135290-135312
Sequence GCGCGCGCGCGTGCGTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203255387_1203255393 7 Left 1203255387 22_KI270733v1_random:135260-135282 CCCTCGACACAAGGGTTTGTCCG No data
Right 1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG No data
1203255388_1203255393 6 Left 1203255388 22_KI270733v1_random:135261-135283 CCTCGACACAAGGGTTTGTCCGC No data
Right 1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203255393 Original CRISPR GCGCGCGCGCGTGCGTGCGG GGG Intergenic