ID: 1203255598

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:135902-135924
Sequence CGGAGCGTCCCCGTCTCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203255586_1203255598 27 Left 1203255586 22_KI270733v1_random:135852-135874 CCTTCTCCACCGAGCGGCGTGTA No data
Right 1203255598 22_KI270733v1_random:135902-135924 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255592_1203255598 -2 Left 1203255592 22_KI270733v1_random:135881-135903 CCCGTCGGGACGAACCGCAACCG No data
Right 1203255598 22_KI270733v1_random:135902-135924 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255588_1203255598 21 Left 1203255588 22_KI270733v1_random:135858-135880 CCACCGAGCGGCGTGTAGGAGTG No data
Right 1203255598 22_KI270733v1_random:135902-135924 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255589_1203255598 18 Left 1203255589 22_KI270733v1_random:135861-135883 CCGAGCGGCGTGTAGGAGTGCCC No data
Right 1203255598 22_KI270733v1_random:135902-135924 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255593_1203255598 -3 Left 1203255593 22_KI270733v1_random:135882-135904 CCGTCGGGACGAACCGCAACCGG No data
Right 1203255598 22_KI270733v1_random:135902-135924 CGGAGCGTCCCCGTCTCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203255598 Original CRISPR CGGAGCGTCCCCGTCTCGGT CGG Intergenic
No off target data available for this crispr