ID: 1203255949

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:138054-138076
Sequence CGGAGCGTCCCCGTCTCGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203255938_1203255949 27 Left 1203255938 22_KI270733v1_random:138004-138026 CCTTCTCCACCGAGCGGCGTGTA No data
Right 1203255949 22_KI270733v1_random:138054-138076 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255940_1203255949 18 Left 1203255940 22_KI270733v1_random:138013-138035 CCGAGCGGCGTGTAAGAGTGCCC No data
Right 1203255949 22_KI270733v1_random:138054-138076 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255939_1203255949 21 Left 1203255939 22_KI270733v1_random:138010-138032 CCACCGAGCGGCGTGTAAGAGTG No data
Right 1203255949 22_KI270733v1_random:138054-138076 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255944_1203255949 -3 Left 1203255944 22_KI270733v1_random:138034-138056 CCGTCGGGACGAACCGCAACCGG No data
Right 1203255949 22_KI270733v1_random:138054-138076 CGGAGCGTCCCCGTCTCGGTCGG No data
1203255943_1203255949 -2 Left 1203255943 22_KI270733v1_random:138033-138055 CCCGTCGGGACGAACCGCAACCG No data
Right 1203255949 22_KI270733v1_random:138054-138076 CGGAGCGTCCCCGTCTCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203255949 Original CRISPR CGGAGCGTCCCCGTCTCGGT CGG Intergenic
No off target data available for this crispr