ID: 1203257731

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:152551-152573
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203257731_1203257741 3 Left 1203257731 22_KI270733v1_random:152551-152573 CCGGCTCCCCCCACTACCCACGT No data
Right 1203257741 22_KI270733v1_random:152577-152599 TTCACCTTAATTTAGTGAGTCGG No data
1203257731_1203257744 11 Left 1203257731 22_KI270733v1_random:152551-152573 CCGGCTCCCCCCACTACCCACGT No data
Right 1203257744 22_KI270733v1_random:152585-152607 AATTTAGTGAGTCGGTTAGGTGG No data
1203257731_1203257745 12 Left 1203257731 22_KI270733v1_random:152551-152573 CCGGCTCCCCCCACTACCCACGT No data
Right 1203257745 22_KI270733v1_random:152586-152608 ATTTAGTGAGTCGGTTAGGTGGG No data
1203257731_1203257743 8 Left 1203257731 22_KI270733v1_random:152551-152573 CCGGCTCCCCCCACTACCCACGT No data
Right 1203257743 22_KI270733v1_random:152582-152604 CTTAATTTAGTGAGTCGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203257731 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr