ID: 1203258040

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:155430-155452
Sequence GATACCTCTGCATTGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203258038_1203258040 -10 Left 1203258038 22_KI270733v1_random:155417-155439 CCGAGGTCAAATGGATACCTCTG No data
Right 1203258040 22_KI270733v1_random:155430-155452 GATACCTCTGCATTGGCCCGAGG No data
1203258036_1203258040 -6 Left 1203258036 22_KI270733v1_random:155413-155435 CCCACCGAGGTCAAATGGATACC No data
Right 1203258040 22_KI270733v1_random:155430-155452 GATACCTCTGCATTGGCCCGAGG No data
1203258032_1203258040 11 Left 1203258032 22_KI270733v1_random:155396-155418 CCGCAAAGCTGACCTGTCCCACC No data
Right 1203258040 22_KI270733v1_random:155430-155452 GATACCTCTGCATTGGCCCGAGG No data
1203258037_1203258040 -7 Left 1203258037 22_KI270733v1_random:155414-155436 CCACCGAGGTCAAATGGATACCT No data
Right 1203258040 22_KI270733v1_random:155430-155452 GATACCTCTGCATTGGCCCGAGG No data
1203258034_1203258040 -1 Left 1203258034 22_KI270733v1_random:155408-155430 CCTGTCCCACCGAGGTCAAATGG No data
Right 1203258040 22_KI270733v1_random:155430-155452 GATACCTCTGCATTGGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203258040 Original CRISPR GATACCTCTGCATTGGCCCG AGG Intergenic
No off target data available for this crispr