ID: 1203258193

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:156020-156042
Sequence AATCTATTTTGTGGCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203258193_1203258200 5 Left 1203258193 22_KI270733v1_random:156020-156042 CCCTTGAGGCCACAAAATAGATT No data
Right 1203258200 22_KI270733v1_random:156048-156070 CCACCCATCGACGTTTCCCCCGG No data
1203258193_1203258204 12 Left 1203258193 22_KI270733v1_random:156020-156042 CCCTTGAGGCCACAAAATAGATT No data
Right 1203258204 22_KI270733v1_random:156055-156077 TCGACGTTTCCCCCGGGTGCTGG No data
1203258193_1203258201 6 Left 1203258193 22_KI270733v1_random:156020-156042 CCCTTGAGGCCACAAAATAGATT No data
Right 1203258201 22_KI270733v1_random:156049-156071 CACCCATCGACGTTTCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203258193 Original CRISPR AATCTATTTTGTGGCCTCAA GGG (reversed) Intergenic
No off target data available for this crispr