ID: 1203258206

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:156065-156087
Sequence CAGGATACATCCAGCACCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203258206_1203258213 23 Left 1203258206 22_KI270733v1_random:156065-156087 CCCCGGGTGCTGGATGTATCCTG No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203258206 Original CRISPR CAGGATACATCCAGCACCCG GGG (reversed) Intergenic
No off target data available for this crispr