ID: 1203258210

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:156096-156118
Sequence AATTCGACGGTGTCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203258210_1203258215 21 Left 1203258210 22_KI270733v1_random:156096-156118 CCTGAGCCTGACACCGTCGAATT No data
Right 1203258215 22_KI270733v1_random:156140-156162 GTGTTTGTTTGTTTCTGAGATGG No data
1203258210_1203258213 -8 Left 1203258210 22_KI270733v1_random:156096-156118 CCTGAGCCTGACACCGTCGAATT No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203258210 Original CRISPR AATTCGACGGTGTCAGGCTC AGG (reversed) Intergenic