ID: 1203258210 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22_KI270733v1_random:156096-156118 |
Sequence | AATTCGACGGTGTCAGGCTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1203258210_1203258215 | 21 | Left | 1203258210 | 22_KI270733v1_random:156096-156118 | CCTGAGCCTGACACCGTCGAATT | No data | ||
Right | 1203258215 | 22_KI270733v1_random:156140-156162 | GTGTTTGTTTGTTTCTGAGATGG | No data | ||||
1203258210_1203258213 | -8 | Left | 1203258210 | 22_KI270733v1_random:156096-156118 | CCTGAGCCTGACACCGTCGAATT | No data | ||
Right | 1203258213 | 22_KI270733v1_random:156111-156133 | GTCGAATTAAACACCTTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203258210 | Original CRISPR | AATTCGACGGTGTCAGGCTC AGG (reversed) | Intergenic | ||