ID: 1203258213

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:156111-156133
Sequence GTCGAATTAAACACCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203258206_1203258213 23 Left 1203258206 22_KI270733v1_random:156065-156087 CCCCGGGTGCTGGATGTATCCTG No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data
1203258210_1203258213 -8 Left 1203258210 22_KI270733v1_random:156096-156118 CCTGAGCCTGACACCGTCGAATT No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data
1203258209_1203258213 4 Left 1203258209 22_KI270733v1_random:156084-156106 CCTGTCAAGAGACCTGAGCCTGA No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data
1203258205_1203258213 24 Left 1203258205 22_KI270733v1_random:156064-156086 CCCCCGGGTGCTGGATGTATCCT No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data
1203258207_1203258213 22 Left 1203258207 22_KI270733v1_random:156066-156088 CCCGGGTGCTGGATGTATCCTGT No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data
1203258208_1203258213 21 Left 1203258208 22_KI270733v1_random:156067-156089 CCGGGTGCTGGATGTATCCTGTC No data
Right 1203258213 22_KI270733v1_random:156111-156133 GTCGAATTAAACACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203258213 Original CRISPR GTCGAATTAAACACCTTGAC TGG Intergenic
No off target data available for this crispr