ID: 1203258215

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:156140-156162
Sequence GTGTTTGTTTGTTTCTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203258211_1203258215 15 Left 1203258211 22_KI270733v1_random:156102-156124 CCTGACACCGTCGAATTAAACAC No data
Right 1203258215 22_KI270733v1_random:156140-156162 GTGTTTGTTTGTTTCTGAGATGG No data
1203258214_1203258215 -7 Left 1203258214 22_KI270733v1_random:156124-156146 CCTTGACTGGCTTTGTGTGTTTG No data
Right 1203258215 22_KI270733v1_random:156140-156162 GTGTTTGTTTGTTTCTGAGATGG No data
1203258210_1203258215 21 Left 1203258210 22_KI270733v1_random:156096-156118 CCTGAGCCTGACACCGTCGAATT No data
Right 1203258215 22_KI270733v1_random:156140-156162 GTGTTTGTTTGTTTCTGAGATGG No data
1203258212_1203258215 8 Left 1203258212 22_KI270733v1_random:156109-156131 CCGTCGAATTAAACACCTTGACT No data
Right 1203258215 22_KI270733v1_random:156140-156162 GTGTTTGTTTGTTTCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203258215 Original CRISPR GTGTTTGTTTGTTTCTGAGA TGG Intergenic
No off target data available for this crispr