ID: 1203258497

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:159093-159115
Sequence CTTTTTTGAAGGGGCTCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203258486_1203258497 28 Left 1203258486 22_KI270733v1_random:159042-159064 CCTCTGCGAGAAGACAGACGGTG No data
Right 1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG No data
1203258483_1203258497 30 Left 1203258483 22_KI270733v1_random:159040-159062 CCCCTCTGCGAGAAGACAGACGG No data
Right 1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG No data
1203258485_1203258497 29 Left 1203258485 22_KI270733v1_random:159041-159063 CCCTCTGCGAGAAGACAGACGGT No data
Right 1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG No data
1203258492_1203258497 -6 Left 1203258492 22_KI270733v1_random:159076-159098 CCGATTCTGGCAACAGGCTTTTT No data
Right 1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG No data
1203258490_1203258497 3 Left 1203258490 22_KI270733v1_random:159067-159089 CCGGTTTGGCCGATTCTGGCAAC No data
Right 1203258497 22_KI270733v1_random:159093-159115 CTTTTTTGAAGGGGCTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203258497 Original CRISPR CTTTTTTGAAGGGGCTCCGG TGG Intergenic
No off target data available for this crispr