ID: 1203259655

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:166892-166914
Sequence GCTCCCCGGCACCCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259655_1203259666 -2 Left 1203259655 22_KI270733v1_random:166892-166914 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203259666 22_KI270733v1_random:166913-166935 GCGGTCCCCGGGCCGGGCCGCGG No data
1203259655_1203259673 22 Left 1203259655 22_KI270733v1_random:166892-166914 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203259673 22_KI270733v1_random:166937-166959 CCCTCTGCCGCGATCCTTTCTGG No data
1203259655_1203259664 -9 Left 1203259655 22_KI270733v1_random:166892-166914 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203259664 22_KI270733v1_random:166906-166928 CCGGGGAGCGGTCCCCGGGCCGG No data
1203259655_1203259665 -8 Left 1203259655 22_KI270733v1_random:166892-166914 CCGTCCCCCGGGTGCCGGGGAGC No data
Right 1203259665 22_KI270733v1_random:166907-166929 CGGGGAGCGGTCCCCGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259655 Original CRISPR GCTCCCCGGCACCCGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr