ID: 1203259952

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167908-167930
Sequence CACCGCCGGCGGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259952_1203259963 -5 Left 1203259952 22_KI270733v1_random:167908-167930 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203259963 22_KI270733v1_random:167926-167948 CGGTGCGTGTGGGAAGGCGTGGG No data
1203259952_1203259962 -6 Left 1203259952 22_KI270733v1_random:167908-167930 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203259962 22_KI270733v1_random:167925-167947 GCGGTGCGTGTGGGAAGGCGTGG No data
1203259952_1203259964 -4 Left 1203259952 22_KI270733v1_random:167908-167930 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203259964 22_KI270733v1_random:167927-167949 GGTGCGTGTGGGAAGGCGTGGGG No data
1203259952_1203259966 8 Left 1203259952 22_KI270733v1_random:167908-167930 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259952_1203259965 1 Left 1203259952 22_KI270733v1_random:167908-167930 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259952 Original CRISPR CACCGCCGGCGGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr