ID: 1203259965

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167932-167954
Sequence GTGTGGGAAGGCGTGGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259954_1203259965 -5 Left 1203259954 22_KI270733v1_random:167914-167936 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259946_1203259965 23 Left 1203259946 22_KI270733v1_random:167886-167908 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259945_1203259965 24 Left 1203259945 22_KI270733v1_random:167885-167907 CCCGCGGGGGTCCCCTCGTCTCT No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259959_1203259965 -10 Left 1203259959 22_KI270733v1_random:167919-167941 CCGCCGGCGGTGCGTGTGGGAAG No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259947_1203259965 13 Left 1203259947 22_KI270733v1_random:167896-167918 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259952_1203259965 1 Left 1203259952 22_KI270733v1_random:167908-167930 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259943_1203259965 28 Left 1203259943 22_KI270733v1_random:167881-167903 CCGCCCCGCGGGGGTCCCCTCGT No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259948_1203259965 12 Left 1203259948 22_KI270733v1_random:167897-167919 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259955_1203259965 -6 Left 1203259955 22_KI270733v1_random:167915-167937 CCGCCCGCCGGCGGTGCGTGTGG No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259944_1203259965 25 Left 1203259944 22_KI270733v1_random:167884-167906 CCCCGCGGGGGTCCCCTCGTCTC No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259953_1203259965 -4 Left 1203259953 22_KI270733v1_random:167913-167935 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259958_1203259965 -9 Left 1203259958 22_KI270733v1_random:167918-167940 CCCGCCGGCGGTGCGTGTGGGAA No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data
1203259949_1203259965 11 Left 1203259949 22_KI270733v1_random:167898-167920 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1203259965 22_KI270733v1_random:167932-167954 GTGTGGGAAGGCGTGGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259965 Original CRISPR GTGTGGGAAGGCGTGGGGTG CGG Intergenic
No off target data available for this crispr