ID: 1203259966

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167939-167961
Sequence AAGGCGTGGGGTGCGGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259961_1203259966 -6 Left 1203259961 22_KI270733v1_random:167922-167944 CCGGCGGTGCGTGTGGGAAGGCG No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259949_1203259966 18 Left 1203259949 22_KI270733v1_random:167898-167920 CCTCGTCTCTCCTCTCCCCGCCC No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259954_1203259966 2 Left 1203259954 22_KI270733v1_random:167914-167936 CCCGCCCGCCGGCGGTGCGTGTG No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259953_1203259966 3 Left 1203259953 22_KI270733v1_random:167913-167935 CCCCGCCCGCCGGCGGTGCGTGT No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259959_1203259966 -3 Left 1203259959 22_KI270733v1_random:167919-167941 CCGCCGGCGGTGCGTGTGGGAAG No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259958_1203259966 -2 Left 1203259958 22_KI270733v1_random:167918-167940 CCCGCCGGCGGTGCGTGTGGGAA No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259952_1203259966 8 Left 1203259952 22_KI270733v1_random:167908-167930 CCTCTCCCCGCCCGCCGGCGGTG No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259955_1203259966 1 Left 1203259955 22_KI270733v1_random:167915-167937 CCGCCCGCCGGCGGTGCGTGTGG No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259948_1203259966 19 Left 1203259948 22_KI270733v1_random:167897-167919 CCCTCGTCTCTCCTCTCCCCGCC No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259946_1203259966 30 Left 1203259946 22_KI270733v1_random:167886-167908 CCGCGGGGGTCCCCTCGTCTCTC No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data
1203259947_1203259966 20 Left 1203259947 22_KI270733v1_random:167896-167918 CCCCTCGTCTCTCCTCTCCCCGC No data
Right 1203259966 22_KI270733v1_random:167939-167961 AAGGCGTGGGGTGCGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259966 Original CRISPR AAGGCGTGGGGTGCGGACCC CGG Intergenic
No off target data available for this crispr