ID: 1203259968

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167957-167979
Sequence CGGGACGGCGAGGTCGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259968_1203259986 12 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259968_1203259987 13 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259968_1203259985 9 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259985 22_KI270733v1_random:167989-168011 TTCTGCGTCGCGGGGCGGGCCGG No data
1203259968_1203259982 4 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259982 22_KI270733v1_random:167984-168006 CCGCCTTCTGCGTCGCGGGGCGG No data
1203259968_1203259978 0 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259978 22_KI270733v1_random:167980-168002 CCCGCCGCCTTCTGCGTCGCGGG No data
1203259968_1203259988 14 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259968_1203259976 -1 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259976 22_KI270733v1_random:167979-168001 GCCCGCCGCCTTCTGCGTCGCGG No data
1203259968_1203259983 5 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG No data
1203259968_1203259980 1 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259980 22_KI270733v1_random:167981-168003 CCGCCGCCTTCTGCGTCGCGGGG No data
1203259968_1203259989 27 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259989 22_KI270733v1_random:168007-168029 GCCGGCGGGGTCCTCCGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259968 Original CRISPR CGGGACGGCGAGGTCGGGCC GGG (reversed) Intergenic
No off target data available for this crispr