ID: 1203259969

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167958-167980
Sequence GCGGGACGGCGAGGTCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259969_1203259989 26 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259989 22_KI270733v1_random:168007-168029 GCCGGCGGGGTCCTCCGACGCGG No data
1203259969_1203259982 3 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259982 22_KI270733v1_random:167984-168006 CCGCCTTCTGCGTCGCGGGGCGG No data
1203259969_1203259978 -1 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259978 22_KI270733v1_random:167980-168002 CCCGCCGCCTTCTGCGTCGCGGG No data
1203259969_1203259976 -2 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259976 22_KI270733v1_random:167979-168001 GCCCGCCGCCTTCTGCGTCGCGG No data
1203259969_1203259985 8 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259985 22_KI270733v1_random:167989-168011 TTCTGCGTCGCGGGGCGGGCCGG No data
1203259969_1203259987 12 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259969_1203259980 0 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259980 22_KI270733v1_random:167981-168003 CCGCCGCCTTCTGCGTCGCGGGG No data
1203259969_1203259983 4 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG No data
1203259969_1203259988 13 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259969_1203259986 11 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259969 Original CRISPR GCGGGACGGCGAGGTCGGGC CGG (reversed) Intergenic