ID: 1203259971

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167963-167985
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259971_1203259986 6 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259971_1203259983 -1 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84
1203259971_1203259988 8 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259971_1203259989 21 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259989 22_KI270733v1_random:168007-168029 GCCGGCGGGGTCCTCCGACGCGG No data
1203259971_1203259987 7 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259971_1203259982 -2 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259982 22_KI270733v1_random:167984-168006 CCGCCTTCTGCGTCGCGGGGCGG No data
1203259971_1203259985 3 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259985 22_KI270733v1_random:167989-168011 TTCTGCGTCGCGGGGCGGGCCGG No data
1203259971_1203259978 -6 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259978 22_KI270733v1_random:167980-168002 CCCGCCGCCTTCTGCGTCGCGGG No data
1203259971_1203259976 -7 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259976 22_KI270733v1_random:167979-168001 GCCCGCCGCCTTCTGCGTCGCGG No data
1203259971_1203259980 -5 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259980 22_KI270733v1_random:167981-168003 CCGCCGCCTTCTGCGTCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259971 Original CRISPR GGCGGGCGGGACGGCGAGGT CGG (reversed) Intergenic