ID: 1203259974

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167976-167998
Sequence CGACGCAGAAGGCGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259974_1203259986 -7 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259974_1203259987 -6 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259974_1203259989 8 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259989 22_KI270733v1_random:168007-168029 GCCGGCGGGGTCCTCCGACGCGG No data
1203259974_1203259985 -10 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259985 22_KI270733v1_random:167989-168011 TTCTGCGTCGCGGGGCGGGCCGG No data
1203259974_1203259988 -5 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259974 Original CRISPR CGACGCAGAAGGCGGCGGGC GGG (reversed) Intergenic