ID: 1203259975

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167977-167999
Sequence GCGACGCAGAAGGCGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259975_1203259989 7 Left 1203259975 22_KI270733v1_random:167977-167999 CCGCCCGCCGCCTTCTGCGTCGC No data
Right 1203259989 22_KI270733v1_random:168007-168029 GCCGGCGGGGTCCTCCGACGCGG No data
1203259975_1203259986 -8 Left 1203259975 22_KI270733v1_random:167977-167999 CCGCCCGCCGCCTTCTGCGTCGC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259975_1203259987 -7 Left 1203259975 22_KI270733v1_random:167977-167999 CCGCCCGCCGCCTTCTGCGTCGC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259975_1203259988 -6 Left 1203259975 22_KI270733v1_random:167977-167999 CCGCCCGCCGCCTTCTGCGTCGC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259975 Original CRISPR GCGACGCAGAAGGCGGCGGG CGG (reversed) Intergenic
No off target data available for this crispr