ID: 1203259979

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167981-168003
Sequence CCCCGCGACGCAGAAGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259979_1203259988 -10 Left 1203259979 22_KI270733v1_random:167981-168003 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259979_1203259989 3 Left 1203259979 22_KI270733v1_random:167981-168003 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1203259989 22_KI270733v1_random:168007-168029 GCCGGCGGGGTCCTCCGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259979 Original CRISPR CCCCGCGACGCAGAAGGCGG CGG (reversed) Intergenic
No off target data available for this crispr