ID: 1203259979 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22_KI270733v1_random:167981-168003 |
Sequence | CCCCGCGACGCAGAAGGCGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1203259979_1203259989 | 3 | Left | 1203259979 | 22_KI270733v1_random:167981-168003 | CCGCCGCCTTCTGCGTCGCGGGG | No data | ||
Right | 1203259989 | 22_KI270733v1_random:168007-168029 | GCCGGCGGGGTCCTCCGACGCGG | No data | ||||
1203259979_1203259988 | -10 | Left | 1203259979 | 22_KI270733v1_random:167981-168003 | CCGCCGCCTTCTGCGTCGCGGGG | No data | ||
Right | 1203259988 | 22_KI270733v1_random:167994-168016 | CGTCGCGGGGCGGGCCGGCGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203259979 | Original CRISPR | CCCCGCGACGCAGAAGGCGG CGG (reversed) | Intergenic | ||