ID: 1203259981 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22_KI270733v1_random:167984-168006 |
| Sequence | CCGCCCCGCGACGCAGAAGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203259981_1203259989 | 0 | Left | 1203259981 | 22_KI270733v1_random:167984-168006 | CCGCCTTCTGCGTCGCGGGGCGG | No data | ||
| Right | 1203259989 | 22_KI270733v1_random:168007-168029 | GCCGGCGGGGTCCTCCGACGCGG | No data | ||||
| 1203259981_1203259993 | 29 | Left | 1203259981 | 22_KI270733v1_random:167984-168006 | CCGCCTTCTGCGTCGCGGGGCGG | No data | ||
| Right | 1203259993 | 22_KI270733v1_random:168036-168058 | GCCCTCGCTGTCGCCTCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203259981 | Original CRISPR | CCGCCCCGCGACGCAGAAGG CGG (reversed) | Intergenic | ||