ID: 1203259983

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167985-168007
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 4, 1: 0, 2: 5, 3: 8, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259970_1203259983 0 Left 1203259970 22_KI270733v1_random:167962-167984 CCCGACCTCGCCGTCCCGCCCGC No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84
1203259972_1203259983 -5 Left 1203259972 22_KI270733v1_random:167967-167989 CCTCGCCGTCCCGCCCGCCGCCT No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84
1203259973_1203259983 -10 Left 1203259973 22_KI270733v1_random:167972-167994 CCGTCCCGCCCGCCGCCTTCTGC No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84
1203259969_1203259983 4 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84
1203259967_1203259983 6 Left 1203259967 22_KI270733v1_random:167956-167978 CCCCGGCCCGACCTCGCCGTCCC No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84
1203259971_1203259983 -1 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84
1203259968_1203259983 5 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259983 22_KI270733v1_random:167985-168007 CGCCTTCTGCGTCGCGGGGCGGG 0: 4
1: 0
2: 5
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259983 Original CRISPR CGCCTTCTGCGTCGCGGGGC GGG Intergenic