ID: 1203259984 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22_KI270733v1_random:167987-168009 |
Sequence | GGCCCGCCCCGCGACGCAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1203259984_1203259993 | 26 | Left | 1203259984 | 22_KI270733v1_random:167987-168009 | CCTTCTGCGTCGCGGGGCGGGCC | No data | ||
Right | 1203259993 | 22_KI270733v1_random:168036-168058 | GCCCTCGCTGTCGCCTCCAGTGG | No data | ||||
1203259984_1203259989 | -3 | Left | 1203259984 | 22_KI270733v1_random:167987-168009 | CCTTCTGCGTCGCGGGGCGGGCC | No data | ||
Right | 1203259989 | 22_KI270733v1_random:168007-168029 | GCCGGCGGGGTCCTCCGACGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203259984 | Original CRISPR | GGCCCGCCCCGCGACGCAGA AGG (reversed) | Intergenic | ||