ID: 1203259986

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167992-168014
Sequence TGCGTCGCGGGGCGGGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259973_1203259986 -3 Left 1203259973 22_KI270733v1_random:167972-167994 CCGTCCCGCCCGCCGCCTTCTGC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259970_1203259986 7 Left 1203259970 22_KI270733v1_random:167962-167984 CCCGACCTCGCCGTCCCGCCCGC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259972_1203259986 2 Left 1203259972 22_KI270733v1_random:167967-167989 CCTCGCCGTCCCGCCCGCCGCCT No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259971_1203259986 6 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259967_1203259986 13 Left 1203259967 22_KI270733v1_random:167956-167978 CCCCGGCCCGACCTCGCCGTCCC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259974_1203259986 -7 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259975_1203259986 -8 Left 1203259975 22_KI270733v1_random:167977-167999 CCGCCCGCCGCCTTCTGCGTCGC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259969_1203259986 11 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data
1203259968_1203259986 12 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259986 22_KI270733v1_random:167992-168014 TGCGTCGCGGGGCGGGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259986 Original CRISPR TGCGTCGCGGGGCGGGCCGG CGG Intergenic