ID: 1203259987

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167993-168015
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259972_1203259987 3 Left 1203259972 22_KI270733v1_random:167967-167989 CCTCGCCGTCCCGCCCGCCGCCT No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259971_1203259987 7 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259977_1203259987 -10 Left 1203259977 22_KI270733v1_random:167980-168002 CCCGCCGCCTTCTGCGTCGCGGG No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259975_1203259987 -7 Left 1203259975 22_KI270733v1_random:167977-167999 CCGCCCGCCGCCTTCTGCGTCGC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259967_1203259987 14 Left 1203259967 22_KI270733v1_random:167956-167978 CCCCGGCCCGACCTCGCCGTCCC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259973_1203259987 -2 Left 1203259973 22_KI270733v1_random:167972-167994 CCGTCCCGCCCGCCGCCTTCTGC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259970_1203259987 8 Left 1203259970 22_KI270733v1_random:167962-167984 CCCGACCTCGCCGTCCCGCCCGC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259969_1203259987 12 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259968_1203259987 13 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data
1203259974_1203259987 -6 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259987 22_KI270733v1_random:167993-168015 GCGTCGCGGGGCGGGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259987 Original CRISPR GCGTCGCGGGGCGGGCCGGC GGG Intergenic