ID: 1203259988 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22_KI270733v1_random:167994-168016 |
Sequence | CGTCGCGGGGCGGGCCGGCG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 630 | |||
Summary | {0: 4, 1: 0, 2: 3, 3: 53, 4: 570} |
Found 11 Related Crispr Pairs
Show Crispr PairsNote: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203259988 | Original CRISPR | CGTCGCGGGGCGGGCCGGCG GGG | Intergenic | ||