ID: 1203259988

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:167994-168016
Sequence CGTCGCGGGGCGGGCCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203259971_1203259988 8 Left 1203259971 22_KI270733v1_random:167963-167985 CCGACCTCGCCGTCCCGCCCGCC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259975_1203259988 -6 Left 1203259975 22_KI270733v1_random:167977-167999 CCGCCCGCCGCCTTCTGCGTCGC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259967_1203259988 15 Left 1203259967 22_KI270733v1_random:167956-167978 CCCCGGCCCGACCTCGCCGTCCC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259974_1203259988 -5 Left 1203259974 22_KI270733v1_random:167976-167998 CCCGCCCGCCGCCTTCTGCGTCG No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259968_1203259988 14 Left 1203259968 22_KI270733v1_random:167957-167979 CCCGGCCCGACCTCGCCGTCCCG No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259979_1203259988 -10 Left 1203259979 22_KI270733v1_random:167981-168003 CCGCCGCCTTCTGCGTCGCGGGG No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259969_1203259988 13 Left 1203259969 22_KI270733v1_random:167958-167980 CCGGCCCGACCTCGCCGTCCCGC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259977_1203259988 -9 Left 1203259977 22_KI270733v1_random:167980-168002 CCCGCCGCCTTCTGCGTCGCGGG No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259972_1203259988 4 Left 1203259972 22_KI270733v1_random:167967-167989 CCTCGCCGTCCCGCCCGCCGCCT No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259973_1203259988 -1 Left 1203259973 22_KI270733v1_random:167972-167994 CCGTCCCGCCCGCCGCCTTCTGC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data
1203259970_1203259988 9 Left 1203259970 22_KI270733v1_random:167962-167984 CCCGACCTCGCCGTCCCGCCCGC No data
Right 1203259988 22_KI270733v1_random:167994-168016 CGTCGCGGGGCGGGCCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203259988 Original CRISPR CGTCGCGGGGCGGGCCGGCG GGG Intergenic
No off target data available for this crispr