ID: 1203260052

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168237-168259
Sequence GGAGGAGGGGGCGCCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260052_1203260074 29 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260074 22_KI270733v1_random:168289-168311 CCTGAGGGAGCTCGTCGGTGTGG No data
1203260052_1203260065 4 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260065 22_KI270733v1_random:168264-168286 GCCGCCGCGGTGTCCGCGCGTGG No data
1203260052_1203260072 24 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260072 22_KI270733v1_random:168284-168306 TGGGTCCTGAGGGAGCTCGTCGG 0: 16
1: 3
2: 0
3: 13
4: 176
1203260052_1203260070 14 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260070 22_KI270733v1_random:168274-168296 TGTCCGCGCGTGGGTCCTGAGGG No data
1203260052_1203260061 -9 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
1203260052_1203260075 30 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260052_1203260069 13 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260052_1203260067 5 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260067 22_KI270733v1_random:168265-168287 CCGCCGCGGTGTCCGCGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260052 Original CRISPR GGAGGAGGGGGCGCCGGGGG CGG (reversed) Intergenic
No off target data available for this crispr