ID: 1203260057

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168243-168265
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260057_1203260067 -1 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260067 22_KI270733v1_random:168265-168287 CCGCCGCGGTGTCCGCGCGTGGG No data
1203260057_1203260069 7 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260057_1203260074 23 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260074 22_KI270733v1_random:168289-168311 CCTGAGGGAGCTCGTCGGTGTGG No data
1203260057_1203260075 24 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260057_1203260076 25 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260076 22_KI270733v1_random:168291-168313 TGAGGGAGCTCGTCGGTGTGGGG No data
1203260057_1203260065 -2 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260065 22_KI270733v1_random:168264-168286 GCCGCCGCGGTGTCCGCGCGTGG No data
1203260057_1203260072 18 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260072 22_KI270733v1_random:168284-168306 TGGGTCCTGAGGGAGCTCGTCGG No data
1203260057_1203260070 8 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260070 22_KI270733v1_random:168274-168296 TGTCCGCGCGTGGGTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260057 Original CRISPR GCGACCGGAGGAGGGGGCGC CGG (reversed) Intergenic