ID: 1203260061

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168251-168273
Sequence CCCTCCTCCGGTCGCCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260048_1203260061 18 Left 1203260048 22_KI270733v1_random:168210-168232 CCGAGGCCGAACGGTGGTGTGTC No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
1203260051_1203260061 -8 Left 1203260051 22_KI270733v1_random:168236-168258 CCCGCCCCCGGCGCCCCCTCCTC No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
1203260049_1203260061 12 Left 1203260049 22_KI270733v1_random:168216-168238 CCGAACGGTGGTGTGTCGTTCCC No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
1203260043_1203260061 29 Left 1203260043 22_KI270733v1_random:168199-168221 CCCTCAGGTGCCCGAGGCCGAAC No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
1203260047_1203260061 19 Left 1203260047 22_KI270733v1_random:168209-168231 CCCGAGGCCGAACGGTGGTGTGT No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
1203260052_1203260061 -9 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
1203260044_1203260061 28 Left 1203260044 22_KI270733v1_random:168200-168222 CCTCAGGTGCCCGAGGCCGAACG No data
Right 1203260061 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260061 Original CRISPR CCCTCCTCCGGTCGCCGCCG CGG Intergenic