ID: 1203260063

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168255-168277
Sequence GACACCGCGGCGGCGACCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260063_1203260078 23 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260063_1203260077 20 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260077 22_KI270733v1_random:168298-168320 GCTCGTCGGTGTGGGGTTCGAGG No data
1203260063_1203260069 -5 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260063_1203260070 -4 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260070 22_KI270733v1_random:168274-168296 TGTCCGCGCGTGGGTCCTGAGGG No data
1203260063_1203260075 12 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260063_1203260076 13 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260076 22_KI270733v1_random:168291-168313 TGAGGGAGCTCGTCGGTGTGGGG No data
1203260063_1203260074 11 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260074 22_KI270733v1_random:168289-168311 CCTGAGGGAGCTCGTCGGTGTGG No data
1203260063_1203260072 6 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260072 22_KI270733v1_random:168284-168306 TGGGTCCTGAGGGAGCTCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260063 Original CRISPR GACACCGCGGCGGCGACCGG AGG (reversed) Intergenic