ID: 1203260069

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168273-168295
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260054_1203260069 10 Left 1203260054 22_KI270733v1_random:168240-168262 CCCCCGGCGCCCCCTCCTCCGGT No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260059_1203260069 0 Left 1203260059 22_KI270733v1_random:168250-168272 CCCCTCCTCCGGTCGCCGCCGCG No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260064_1203260069 -8 Left 1203260064 22_KI270733v1_random:168258-168280 CCGGTCGCCGCCGCGGTGTCCGC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260058_1203260069 1 Left 1203260058 22_KI270733v1_random:168249-168271 CCCCCTCCTCCGGTCGCCGCCGC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260060_1203260069 -1 Left 1203260060 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260055_1203260069 9 Left 1203260055 22_KI270733v1_random:168241-168263 CCCCGGCGCCCCCTCCTCCGGTC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260062_1203260069 -2 Left 1203260062 22_KI270733v1_random:168252-168274 CCTCCTCCGGTCGCCGCCGCGGT No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260057_1203260069 7 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260051_1203260069 14 Left 1203260051 22_KI270733v1_random:168236-168258 CCCGCCCCCGGCGCCCCCTCCTC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260052_1203260069 13 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260056_1203260069 8 Left 1203260056 22_KI270733v1_random:168242-168264 CCCGGCGCCCCCTCCTCCGGTCG No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data
1203260063_1203260069 -5 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260069 22_KI270733v1_random:168273-168295 GTGTCCGCGCGTGGGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260069 Original CRISPR GTGTCCGCGCGTGGGTCCTG AGG Intergenic