ID: 1203260071

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168277-168299
Sequence GCTCCCTCAGGACCCACGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260071_1203260076 -9 Left 1203260071 22_KI270733v1_random:168277-168299 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1203260076 22_KI270733v1_random:168291-168313 TGAGGGAGCTCGTCGGTGTGGGG No data
1203260071_1203260075 -10 Left 1203260071 22_KI270733v1_random:168277-168299 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260071_1203260077 -2 Left 1203260071 22_KI270733v1_random:168277-168299 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1203260077 22_KI270733v1_random:168298-168320 GCTCGTCGGTGTGGGGTTCGAGG No data
1203260071_1203260078 1 Left 1203260071 22_KI270733v1_random:168277-168299 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260071 Original CRISPR GCTCCCTCAGGACCCACGCG CGG (reversed) Intergenic
No off target data available for this crispr