ID: 1203260075

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168290-168312
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260060_1203260075 16 Left 1203260060 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260052_1203260075 30 Left 1203260052 22_KI270733v1_random:168237-168259 CCGCCCCCGGCGCCCCCTCCTCC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260058_1203260075 18 Left 1203260058 22_KI270733v1_random:168249-168271 CCCCCTCCTCCGGTCGCCGCCGC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260059_1203260075 17 Left 1203260059 22_KI270733v1_random:168250-168272 CCCCTCCTCCGGTCGCCGCCGCG No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260062_1203260075 15 Left 1203260062 22_KI270733v1_random:168252-168274 CCTCCTCCGGTCGCCGCCGCGGT No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260054_1203260075 27 Left 1203260054 22_KI270733v1_random:168240-168262 CCCCCGGCGCCCCCTCCTCCGGT No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260055_1203260075 26 Left 1203260055 22_KI270733v1_random:168241-168263 CCCCGGCGCCCCCTCCTCCGGTC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260064_1203260075 9 Left 1203260064 22_KI270733v1_random:168258-168280 CCGGTCGCCGCCGCGGTGTCCGC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260066_1203260075 2 Left 1203260066 22_KI270733v1_random:168265-168287 CCGCCGCGGTGTCCGCGCGTGGG No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260056_1203260075 25 Left 1203260056 22_KI270733v1_random:168242-168264 CCCGGCGCCCCCTCCTCCGGTCG No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260063_1203260075 12 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260071_1203260075 -10 Left 1203260071 22_KI270733v1_random:168277-168299 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260068_1203260075 -1 Left 1203260068 22_KI270733v1_random:168268-168290 CCGCGGTGTCCGCGCGTGGGTCC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data
1203260057_1203260075 24 Left 1203260057 22_KI270733v1_random:168243-168265 CCGGCGCCCCCTCCTCCGGTCGC No data
Right 1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260075 Original CRISPR CTGAGGGAGCTCGTCGGTGT GGG Intergenic