ID: 1203260078

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:168301-168323
Sequence CGTCGGTGTGGGGTTCGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260066_1203260078 13 Left 1203260066 22_KI270733v1_random:168265-168287 CCGCCGCGGTGTCCGCGCGTGGG No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260062_1203260078 26 Left 1203260062 22_KI270733v1_random:168252-168274 CCTCCTCCGGTCGCCGCCGCGGT No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260063_1203260078 23 Left 1203260063 22_KI270733v1_random:168255-168277 CCTCCGGTCGCCGCCGCGGTGTC No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260059_1203260078 28 Left 1203260059 22_KI270733v1_random:168250-168272 CCCCTCCTCCGGTCGCCGCCGCG No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260060_1203260078 27 Left 1203260060 22_KI270733v1_random:168251-168273 CCCTCCTCCGGTCGCCGCCGCGG No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260071_1203260078 1 Left 1203260071 22_KI270733v1_random:168277-168299 CCGCGCGTGGGTCCTGAGGGAGC No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260064_1203260078 20 Left 1203260064 22_KI270733v1_random:168258-168280 CCGGTCGCCGCCGCGGTGTCCGC No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260068_1203260078 10 Left 1203260068 22_KI270733v1_random:168268-168290 CCGCGGTGTCCGCGCGTGGGTCC No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data
1203260058_1203260078 29 Left 1203260058 22_KI270733v1_random:168249-168271 CCCCCTCCTCCGGTCGCCGCCGC No data
Right 1203260078 22_KI270733v1_random:168301-168323 CGTCGGTGTGGGGTTCGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260078 Original CRISPR CGTCGGTGTGGGGTTCGAGG CGG Intergenic