ID: 1203260828

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:170662-170684
Sequence GCGCGCGCGCGCGTGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203260823_1203260828 -5 Left 1203260823 22_KI270733v1_random:170644-170666 CCCGCGGGCGCCGGCCGCGCGCG No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260818_1203260828 9 Left 1203260818 22_KI270733v1_random:170630-170652 CCGCCTCGCCGCCGCCCGCGGGC No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260822_1203260828 -2 Left 1203260822 22_KI270733v1_random:170641-170663 CCGCCCGCGGGCGCCGGCCGCGC No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260824_1203260828 -6 Left 1203260824 22_KI270733v1_random:170645-170667 CCGCGGGCGCCGGCCGCGCGCGC No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260819_1203260828 6 Left 1203260819 22_KI270733v1_random:170633-170655 CCTCGCCGCCGCCCGCGGGCGCC No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260816_1203260828 10 Left 1203260816 22_KI270733v1_random:170629-170651 CCCGCCTCGCCGCCGCCCGCGGG No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260813_1203260828 15 Left 1203260813 22_KI270733v1_random:170624-170646 CCGTCCCCGCCTCGCCGCCGCCC No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260814_1203260828 11 Left 1203260814 22_KI270733v1_random:170628-170650 CCCCGCCTCGCCGCCGCCCGCGG No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data
1203260821_1203260828 1 Left 1203260821 22_KI270733v1_random:170638-170660 CCGCCGCCCGCGGGCGCCGGCCG No data
Right 1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203260828 Original CRISPR GCGCGCGCGCGCGTGGCCGC CGG Intergenic
No off target data available for this crispr