ID: 1203261554

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:173676-173698
Sequence GCGCACGCCACACGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203261554_1203261559 -8 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261559 22_KI270733v1_random:173691-173713 GCGTGCGCCCCGCGCCGTGGGGG No data
1203261554_1203261567 6 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261567 22_KI270733v1_random:173705-173727 CCGTGGGGGCGGGAACCCCCGGG No data
1203261554_1203261565 5 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261565 22_KI270733v1_random:173704-173726 GCCGTGGGGGCGGGAACCCCCGG No data
1203261554_1203261560 -5 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261560 22_KI270733v1_random:173694-173716 TGCGCCCCGCGCCGTGGGGGCGG No data
1203261554_1203261558 -9 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261558 22_KI270733v1_random:173690-173712 GGCGTGCGCCCCGCGCCGTGGGG No data
1203261554_1203261571 20 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261571 22_KI270733v1_random:173719-173741 ACCCCCGGGCGCCTGTGGGGTGG No data
1203261554_1203261569 16 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261569 22_KI270733v1_random:173715-173737 GGGAACCCCCGGGCGCCTGTGGG No data
1203261554_1203261568 15 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261568 22_KI270733v1_random:173714-173736 CGGGAACCCCCGGGCGCCTGTGG No data
1203261554_1203261570 17 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261570 22_KI270733v1_random:173716-173738 GGAACCCCCGGGCGCCTGTGGGG No data
1203261554_1203261561 -4 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261561 22_KI270733v1_random:173695-173717 GCGCCCCGCGCCGTGGGGGCGGG No data
1203261554_1203261557 -10 Left 1203261554 22_KI270733v1_random:173676-173698 CCTGCCGCGCGTGTGGCGTGCGC No data
Right 1203261557 22_KI270733v1_random:173689-173711 TGGCGTGCGCCCCGCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203261554 Original CRISPR GCGCACGCCACACGCGCGGC AGG (reversed) Intergenic