ID: 1203262434

View in Genome Browser
Species Human (GRCh38)
Location 22_KI270733v1_random:176398-176420
Sequence CGTCGCCGGGGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203262434_1203262454 3 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262454 22_KI270733v1_random:176424-176446 GGGGTGCCGCGCGCGGGTCGGGG No data
1203262434_1203262461 13 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262461 22_KI270733v1_random:176434-176456 GCGCGGGTCGGGGGGCGGGGCGG No data
1203262434_1203262450 -4 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262450 22_KI270733v1_random:176417-176439 GACGGGGGGGGTGCCGCGCGCGG No data
1203262434_1203262459 9 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262459 22_KI270733v1_random:176430-176452 CCGCGCGCGGGTCGGGGGGCGGG No data
1203262434_1203262455 4 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262455 22_KI270733v1_random:176425-176447 GGGTGCCGCGCGCGGGTCGGGGG No data
1203262434_1203262460 10 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262460 22_KI270733v1_random:176431-176453 CGCGCGCGGGTCGGGGGGCGGGG No data
1203262434_1203262457 8 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262457 22_KI270733v1_random:176429-176451 GCCGCGCGCGGGTCGGGGGGCGG No data
1203262434_1203262451 -3 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262451 22_KI270733v1_random:176418-176440 ACGGGGGGGGTGCCGCGCGCGGG No data
1203262434_1203262453 2 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262453 22_KI270733v1_random:176423-176445 GGGGGTGCCGCGCGCGGGTCGGG No data
1203262434_1203262456 5 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262456 22_KI270733v1_random:176426-176448 GGTGCCGCGCGCGGGTCGGGGGG No data
1203262434_1203262452 1 Left 1203262434 22_KI270733v1_random:176398-176420 CCCGCGCCCCCGCCCCGGCGACG No data
Right 1203262452 22_KI270733v1_random:176422-176444 GGGGGGTGCCGCGCGCGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203262434 Original CRISPR CGTCGCCGGGGCGGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr